RNA Sequencing:Article Title: Distinct tissue niches contribute to prostate tissue-resident memory CD8 + T cell differentiation and heterogeneity.
Article Snippet: Compound Sakura Finetek Cat#: 4583 Buffer TCL (2x) Qiagen Cat#: 1070498 10% neutral buffered formalin Sigma Aldrich Cat#: HT501128-4L Critical commercial assays BD Cytofix/Cytoperm solution Kit BD Biosciences Cat#: 554714 Foxp3/Transcription Factor Staining Buffer Set Thermo Fisher Scientific Cat#: 00-5523-00 TransIT-LT1 Transfection Reagent Mirus Cat#: MIR 2300 RNeasy Mini Kit Qiagen Cat#: 74106 RNase-Free DNase Set (250) Qiagen Cat#: 79256 Superscript IV First Strand Synthesis System Thermo Fisher Scientific Cat#: 18091200 Dako Protein Block, Serum-Free Agilent Cat#: X090930-2 (Continued on next page) ll OPEN ACCESS Article e3 Immunity 59, 1–19.e1–e10, June 9, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Dako Antibody Diluent with Background Reducing Components Agilent Cat#: S080983-2 VECTASHIELD Vibrance® Antifade Mounting Medium Vector Laboratories Cat#: H-1700-10 LS Columns Miltenyi Biotec Cat#: 130-042 Deposited data Prostate CD3e+ scRNA-seq This paper GEO: GSE296277 Prostate P14 T cell RNA-seq This paper GEO: GSE296276 Prostate spatial transcriptomics This paper GEO: GSE296275 Sexual dimorphism RNA-seq Gal-Oz et al. GEO: GSE124829 Matched normal and tumor prostate scRNaseq data Tuong et al. EGAS00001005787, prostatecellatlas.org Normal mouse prostate Karthaus et al. GEO: GSE146811 ImmgenT D7 CD3e+ scRNA-seq This paper GEO: GSE301271 ImmgenT D30 CD3e+ scRNA-seq This paper GEO: GSE301960 Experimental models: Cell lines PLAT-E Cell Biolabs Cat: #RV-101 Experimental models: Organisms/strains CD45.2 (C57BL/6J) The Jackson Laboratory Strain#: 000664 P14 (B6.Cg-Tcratm1MomTg(TcrLCMV)327Sdz/TacMmjax) The Jackson Laboratory Strain#: 037394-JAX CD45.1 (B6.SJL-PtprcaPepcb/BoyJ) The Jackson Laboratory Strain#: 002014 CD45.1.2 Bred in-house N/A R26creERT2 (B6.129-Gt(ROSA)26Sortm1(cre/ERT2)Tyj/J) The Jackson Laboratory Strain#: 008463 Arfl/fl (B6.129S1-Artm2.1Reb/J) The Jackson Laboratory Strain#: 018450 Il15 KO (B6(Cg)-Il15tm1.2Nsl/J) The Jackson Laboratory Strain#: 034239 Tgfbr2fl/fl (B6;129-Tgfbr2tm1Karl/J) The Jackson Laboratory Strain#: 012603 Oligonucleotides LCMV GP for qPCR – FWD: CATTCACCTGGACTTTGTCAGACTC IDT N/A LCMV GP for qPCR – REV: GCAACTGCTGTGTTCCCGAAA IDT N/A LCMV NP for qPCR – FWD: GCATTGTCTGGCTGTAGCTTA IDT N/A LCMV NP for qPCR – REV: CAATGACGTTGTACAAGCGC IDT N/A HPRT for qPCR – FWD: TGAAGAGCTACTGTAATGATCAGTCAAC IDT N/A HPRT for qPCR – REV: AGCAAGCTTGCAACCTTAACCA IDT N/A Software and algorithms FlowJo software version 10.10.0 FlowJo, LLC https://www.flowjo.com GraphPad Prism 10 GraphPad https://www.graphpad.com R v4.1.2 R Core Team https://www.r-project.org Python Python Software Foundation https://www.python.org/ HPRT for qPCR – REV: AGCAAGCTTGCAACCTTAACCA IDT N/A Other Silk Surgical Sutures, Size 3/0, 18’’Thread with 19mm 3/8 Circle R/C Needle. ..
Spatial Transcriptomics:Article Title: Distinct tissue niches contribute to prostate tissue-resident memory CD8 + T cell differentiation and heterogeneity.
Article Snippet: Compound Sakura Finetek Cat#: 4583 Buffer TCL (2x) Qiagen Cat#: 1070498 10% neutral buffered formalin Sigma Aldrich Cat#: HT501128-4L Critical commercial assays BD Cytofix/Cytoperm solution Kit BD Biosciences Cat#: 554714 Foxp3/Transcription Factor Staining Buffer Set Thermo Fisher Scientific Cat#: 00-5523-00 TransIT-LT1 Transfection Reagent Mirus Cat#: MIR 2300 RNeasy Mini Kit Qiagen Cat#: 74106 RNase-Free DNase Set (250) Qiagen Cat#: 79256 Superscript IV First Strand Synthesis System Thermo Fisher Scientific Cat#: 18091200 Dako Protein Block, Serum-Free Agilent Cat#: X090930-2 (Continued on next page) ll OPEN ACCESS Article e3 Immunity 59, 1–19.e1–e10, June 9, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Dako Antibody Diluent with Background Reducing Components Agilent Cat#: S080983-2 VECTASHIELD Vibrance® Antifade Mounting Medium Vector Laboratories Cat#: H-1700-10 LS Columns Miltenyi Biotec Cat#: 130-042 Deposited data Prostate CD3e+ scRNA-seq This paper GEO: GSE296277 Prostate P14 T cell RNA-seq This paper GEO: GSE296276 Prostate spatial transcriptomics This paper GEO: GSE296275 Sexual dimorphism RNA-seq Gal-Oz et al. GEO: GSE124829 Matched normal and tumor prostate scRNaseq data Tuong et al. EGAS00001005787, prostatecellatlas.org Normal mouse prostate Karthaus et al. GEO: GSE146811 ImmgenT D7 CD3e+ scRNA-seq This paper GEO: GSE301271 ImmgenT D30 CD3e+ scRNA-seq This paper GEO: GSE301960 Experimental models: Cell lines PLAT-E Cell Biolabs Cat: #RV-101 Experimental models: Organisms/strains CD45.2 (C57BL/6J) The Jackson Laboratory Strain#: 000664 P14 (B6.Cg-Tcratm1MomTg(TcrLCMV)327Sdz/TacMmjax) The Jackson Laboratory Strain#: 037394-JAX CD45.1 (B6.SJL-PtprcaPepcb/BoyJ) The Jackson Laboratory Strain#: 002014 CD45.1.2 Bred in-house N/A R26creERT2 (B6.129-Gt(ROSA)26Sortm1(cre/ERT2)Tyj/J) The Jackson Laboratory Strain#: 008463 Arfl/fl (B6.129S1-Artm2.1Reb/J) The Jackson Laboratory Strain#: 018450 Il15 KO (B6(Cg)-Il15tm1.2Nsl/J) The Jackson Laboratory Strain#: 034239 Tgfbr2fl/fl (B6;129-Tgfbr2tm1Karl/J) The Jackson Laboratory Strain#: 012603 Oligonucleotides LCMV GP for qPCR – FWD: CATTCACCTGGACTTTGTCAGACTC IDT N/A LCMV GP for qPCR – REV: GCAACTGCTGTGTTCCCGAAA IDT N/A LCMV NP for qPCR – FWD: GCATTGTCTGGCTGTAGCTTA IDT N/A LCMV NP for qPCR – REV: CAATGACGTTGTACAAGCGC IDT N/A HPRT for qPCR – FWD: TGAAGAGCTACTGTAATGATCAGTCAAC IDT N/A HPRT for qPCR – REV: AGCAAGCTTGCAACCTTAACCA IDT N/A Software and algorithms FlowJo software version 10.10.0 FlowJo, LLC https://www.flowjo.com GraphPad Prism 10 GraphPad https://www.graphpad.com R v4.1.2 R Core Team https://www.r-project.org Python Python Software Foundation https://www.python.org/ HPRT for qPCR – REV: AGCAAGCTTGCAACCTTAACCA IDT N/A Other Silk Surgical Sutures, Size 3/0, 18’’Thread with 19mm 3/8 Circle R/C Needle. ..
Real-time Polymerase Chain Reaction:Article Title: Distinct tissue niches contribute to prostate tissue-resident memory CD8 + T cell differentiation and heterogeneity.
Article Snippet: Compound Sakura Finetek Cat#: 4583 Buffer TCL (2x) Qiagen Cat#: 1070498 10% neutral buffered formalin Sigma Aldrich Cat#: HT501128-4L Critical commercial assays BD Cytofix/Cytoperm solution Kit BD Biosciences Cat#: 554714 Foxp3/Transcription Factor Staining Buffer Set Thermo Fisher Scientific Cat#: 00-5523-00 TransIT-LT1 Transfection Reagent Mirus Cat#: MIR 2300 RNeasy Mini Kit Qiagen Cat#: 74106 RNase-Free DNase Set (250) Qiagen Cat#: 79256 Superscript IV First Strand Synthesis System Thermo Fisher Scientific Cat#: 18091200 Dako Protein Block, Serum-Free Agilent Cat#: X090930-2 (Continued on next page) ll OPEN ACCESS Article e3 Immunity 59, 1–19.e1–e10, June 9, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Dako Antibody Diluent with Background Reducing Components Agilent Cat#: S080983-2 VECTASHIELD Vibrance® Antifade Mounting Medium Vector Laboratories Cat#: H-1700-10 LS Columns Miltenyi Biotec Cat#: 130-042 Deposited data Prostate CD3e+ scRNA-seq This paper GEO: GSE296277 Prostate P14 T cell RNA-seq This paper GEO: GSE296276 Prostate spatial transcriptomics This paper GEO: GSE296275 Sexual dimorphism RNA-seq Gal-Oz et al. GEO: GSE124829 Matched normal and tumor prostate scRNaseq data Tuong et al. EGAS00001005787, prostatecellatlas.org Normal mouse prostate Karthaus et al. GEO: GSE146811 ImmgenT D7 CD3e+ scRNA-seq This paper GEO: GSE301271 ImmgenT D30 CD3e+ scRNA-seq This paper GEO: GSE301960 Experimental models: Cell lines PLAT-E Cell Biolabs Cat: #RV-101 Experimental models: Organisms/strains CD45.2 (C57BL/6J) The Jackson Laboratory Strain#: 000664 P14 (B6.Cg-Tcratm1MomTg(TcrLCMV)327Sdz/TacMmjax) The Jackson Laboratory Strain#: 037394-JAX CD45.1 (B6.SJL-PtprcaPepcb/BoyJ) The Jackson Laboratory Strain#: 002014 CD45.1.2 Bred in-house N/A R26creERT2 (B6.129-Gt(ROSA)26Sortm1(cre/ERT2)Tyj/J) The Jackson Laboratory Strain#: 008463 Arfl/fl (B6.129S1-Artm2.1Reb/J) The Jackson Laboratory Strain#: 018450 Il15 KO (B6(Cg)-Il15tm1.2Nsl/J) The Jackson Laboratory Strain#: 034239 Tgfbr2fl/fl (B6;129-Tgfbr2tm1Karl/J) The Jackson Laboratory Strain#: 012603 Oligonucleotides LCMV GP for qPCR – FWD: CATTCACCTGGACTTTGTCAGACTC IDT N/A LCMV GP for qPCR – REV: GCAACTGCTGTGTTCCCGAAA IDT N/A LCMV NP for qPCR – FWD: GCATTGTCTGGCTGTAGCTTA IDT N/A LCMV NP for qPCR – REV: CAATGACGTTGTACAAGCGC IDT N/A HPRT for qPCR – FWD: TGAAGAGCTACTGTAATGATCAGTCAAC IDT N/A HPRT for qPCR – REV: AGCAAGCTTGCAACCTTAACCA IDT N/A Software and algorithms FlowJo software version 10.10.0 FlowJo, LLC https://www.flowjo.com GraphPad Prism 10 GraphPad https://www.graphpad.com R v4.1.2 R Core Team https://www.r-project.org Python Python Software Foundation https://www.python.org/ HPRT for qPCR – REV: AGCAAGCTTGCAACCTTAACCA IDT N/A Other Silk Surgical Sutures, Size 3/0, 18’’Thread with 19mm 3/8 Circle R/C Needle. ..
Software:Article Title: Distinct tissue niches contribute to prostate tissue-resident memory CD8 + T cell differentiation and heterogeneity.
Article Snippet: Compound Sakura Finetek Cat#: 4583 Buffer TCL (2x) Qiagen Cat#: 1070498 10% neutral buffered formalin Sigma Aldrich Cat#: HT501128-4L Critical commercial assays BD Cytofix/Cytoperm solution Kit BD Biosciences Cat#: 554714 Foxp3/Transcription Factor Staining Buffer Set Thermo Fisher Scientific Cat#: 00-5523-00 TransIT-LT1 Transfection Reagent Mirus Cat#: MIR 2300 RNeasy Mini Kit Qiagen Cat#: 74106 RNase-Free DNase Set (250) Qiagen Cat#: 79256 Superscript IV First Strand Synthesis System Thermo Fisher Scientific Cat#: 18091200 Dako Protein Block, Serum-Free Agilent Cat#: X090930-2 (Continued on next page) ll OPEN ACCESS Article e3 Immunity 59, 1–19.e1–e10, June 9, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Dako Antibody Diluent with Background Reducing Components Agilent Cat#: S080983-2 VECTASHIELD Vibrance® Antifade Mounting Medium Vector Laboratories Cat#: H-1700-10 LS Columns Miltenyi Biotec Cat#: 130-042 Deposited data Prostate CD3e+ scRNA-seq This paper GEO: GSE296277 Prostate P14 T cell RNA-seq This paper GEO: GSE296276 Prostate spatial transcriptomics This paper GEO: GSE296275 Sexual dimorphism RNA-seq Gal-Oz et al. GEO: GSE124829 Matched normal and tumor prostate scRNaseq data Tuong et al. EGAS00001005787, prostatecellatlas.org Normal mouse prostate Karthaus et al. GEO: GSE146811 ImmgenT D7 CD3e+ scRNA-seq This paper GEO: GSE301271 ImmgenT D30 CD3e+ scRNA-seq This paper GEO: GSE301960 Experimental models: Cell lines PLAT-E Cell Biolabs Cat: #RV-101 Experimental models: Organisms/strains CD45.2 (C57BL/6J) The Jackson Laboratory Strain#: 000664 P14 (B6.Cg-Tcratm1MomTg(TcrLCMV)327Sdz/TacMmjax) The Jackson Laboratory Strain#: 037394-JAX CD45.1 (B6.SJL-PtprcaPepcb/BoyJ) The Jackson Laboratory Strain#: 002014 CD45.1.2 Bred in-house N/A R26creERT2 (B6.129-Gt(ROSA)26Sortm1(cre/ERT2)Tyj/J) The Jackson Laboratory Strain#: 008463 Arfl/fl (B6.129S1-Artm2.1Reb/J) The Jackson Laboratory Strain#: 018450 Il15 KO (B6(Cg)-Il15tm1.2Nsl/J) The Jackson Laboratory Strain#: 034239 Tgfbr2fl/fl (B6;129-Tgfbr2tm1Karl/J) The Jackson Laboratory Strain#: 012603 Oligonucleotides LCMV GP for qPCR – FWD: CATTCACCTGGACTTTGTCAGACTC IDT N/A LCMV GP for qPCR – REV: GCAACTGCTGTGTTCCCGAAA IDT N/A LCMV NP for qPCR – FWD: GCATTGTCTGGCTGTAGCTTA IDT N/A LCMV NP for qPCR – REV: CAATGACGTTGTACAAGCGC IDT N/A HPRT for qPCR – FWD: TGAAGAGCTACTGTAATGATCAGTCAAC IDT N/A HPRT for qPCR – REV: AGCAAGCTTGCAACCTTAACCA IDT N/A Software and algorithms FlowJo software version 10.10.0 FlowJo, LLC https://www.flowjo.com GraphPad Prism 10 GraphPad https://www.graphpad.com R v4.1.2 R Core Team https://www.r-project.org Python Python Software Foundation https://www.python.org/ HPRT for qPCR – REV: AGCAAGCTTGCAACCTTAACCA IDT N/A Other Silk Surgical Sutures, Size 3/0, 18’’Thread with 19mm 3/8 Circle R/C Needle. ..
|
Vector Laboratories is a verified supplier 
Vector Laboratories manufactures this product 